Paste a DNA or RNA sequence, or a multi-record FASTA file, to get its GC and AT percentage, exact base counts, GC skew and GC at each codon position. A sliding-window plot shows where GC-rich and AT-rich regions are.
Last updated:
Results update as you type. Spaces, numbers and FASTA headers are ignored.
Base composition
GC by codon position
Reading frame +1 from the first base. GC3 is often used to compare codon usage between genes.
Sliding-window GC content
GC skew (G − C) / (G + C)
Window skewCumulative G − C (right axis)
All FASTA records
Advertisement
Advertisement
How to use the GC Content Calculator
Paste your sequence. Plain text, GenBank-style numbered lines and FASTA (one or many records) all work; spaces and digits are ignored.
Read the summary cards for GC %, AT %, length and skew. Base counts and codon-position GC appear below.
Set the window and step for the sliding-window plot. Smaller windows show local detail; larger windows smooth out noise.
Hover or tap the charts to read the GC % and skew of any window.
Pick another record from the list or the summary table if you pasted a multi-FASTA file.
Download the windows CSV or copy the summary for your notes.
GC content and GC skew formulas
GC content is the share of guanine and cytosine among the bases of a DNA or RNA sequence:
GC % = (G + C) / (A + T + G + C) × 100 and AT % = (A + T) / (A + T + G + C) × 100
For RNA, U takes the place of T. Because G pairs with C through three hydrogen bonds and A with T through two, GC-rich DNA is more stable, melts at a higher temperature and can be harder to amplify by PCR or to sequence evenly.
GC skew compares the two bases on one strand: (G − C) / (G + C). It ranges from −1 (only C) to +1 (only G). The tool also draws the running total of G − C from the first base. In many bacterial chromosomes the leading strand is G-rich, so this cumulative curve reaches its lowest point near the origin of replication and its highest near the terminus.
Worked example
For the 20-base sequence ATGGCGTACGCTAGCTTAGC: A = 4, T = 5, G = 6, C = 5. GC = 11 of 20 bases, so GC content = 55.00% and AT content = 45.00%. GC skew = (6 − 5) / (6 + 5) = +0.0909, and AT skew = (4 − 5) / (4 + 5) = −0.1111.
Typical GC content ranges
Sequence type
Approximate GC content
Notes
Human genome (whole)
about 41%
Varies by region; gene-dense regions are GC-richer
CpG islands
over 50% (often 60–70%)
Usually defined over windows of 200 bp or more with high CpG ratio
Escherichia coli K-12
about 51%
Close to balanced
Plasmodium falciparum
about 19%
One of the most AT-rich genomes known
Streptomyces species
about 70–72%
Very GC-rich soil bacteria
PCR primers
40–60% recommended
Helps keep Tm in a useful range and avoids non-specific binding
Tips
Primers: aim for 40–60% GC with a G or C in the last one or two bases (a "GC clamp"), then check the melting temperature with the Primer Tm Calculator.
Finding genes: coding regions often have a different GC content (especially GC3) than the surrounding DNA. Combine the window plot with the ORF Finder.
Strand matters for skew, not for GC %: the reverse complement has exactly the same GC content but the opposite GC skew.
Noisy plot? Increase the window size. A spiky plot with tiny windows is normal because a few bases change the percentage a lot.
Frequently asked questions
How is GC content calculated?
GC content = (G + C) / (A + T + G + C) × 100. For example ATGCGC has 4 G or C bases out of 6, so its GC content is 66.67%. AT content is simply 100% minus the GC content when only A, T, G and C are present.
How are N and other ambiguous bases handled?
By default they are left out of the denominator, so a run of N in an unfinished assembly does not drag the GC % down. S (G or C) is counted as GC and W (A or T) as AT because their class is known. You can switch either behaviour off in the options.
What is GC skew?
GC skew = (G − C) / (G + C), measured in a window. It is positive where G outnumbers C on the strand you pasted. In many bacteria the skew changes sign at the origin and terminus of replication, so the minimum and maximum of the cumulative G − C curve are used to estimate where they are.
What window size should I use?
For genes and plasmids of a few kilobases, a window of 50 to 200 bp with a step of 10 to 25 bp works well. For whole bacterial genomes use windows of 1,000 to 10,000 bp. The window must be shorter than the sequence; if it isn't, the tool shows one window covering everything.
What are GC1, GC2 and GC3?
They are the GC content at the first, second and third position of each codon, counted in reading frame +1 from the first base. GC3 varies the most between genes and species because many third-position changes do not change the amino acid, so it is a common measure of codon usage bias.
Why does GC content matter?
GC pairs form three hydrogen bonds versus two for AT, so GC-rich DNA has a higher melting temperature. GC content affects PCR primer design, sequencing coverage, and is a classic trait used to compare genomes, which range from under 25% to over 70% GC.
Is my sequence uploaded?
No. All counting and plotting happens in your browser, so unpublished sequences never leave your device.
Are all the tools on FreeToolCabin tested for quality and accuracy?
Yes! Every tool on our site undergoes automated Q/A testing in real browser environments to ensure high precision, correct output, and zero errors. If you happen to spot a bug or have a suggestion, please contact us at [email protected] and our team will review it right away.